Evaluation of zoonotic potency of Escherichia coli O157:H7 through arbitrarily primed PCR methods

Suardana, I Wayan; Widiasih, Dyah Ayu; Mahardika, Gusti Ngurah; Pinatih, Komang Januartha Putra; Daryono, Budi Setiadi

doi:10.1016/j.apjtb.2015.07.023

Cited by 9 publications

(8 citation statements)

References 32 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…coli O157: H7 is food and water-borne zoonotic agent (García, Fox, & Besser, 2010). Infection caused by this bacterium is usually asymptomatic in domestic animals and wildlife (Rahimi, Kazemeini, & Salajegheh, 2012;Suardana, Widiasih, Mahardika, Pinatih, & Daryono, 2015). Human infection usually occurs due to improper hygiene, ingestion of contaminated food and water, or direct contact with infected animals (Ateba & Mbewe, 2014;Bogard, Fuller, Radke, Selman, & Smith, 2013).…”

Section: Escherichia Colimentioning

confidence: 99%

Zoonotic implications of camel diseases in Iran

Mohammadpour

Champour

Tuteja

et al. 2020

Veterinary Medicine & Sci

View full text Add to dashboard Cite

Approximately 60% of all human pathogens and 75% of emerging infectious diseases are zoonotic (of animal origin). Camel zoonotic diseases can be encountered in all camel‐rearing countries. In this article, all studies carried out on camel zoonotic diseases in Iran are reviewed to show the importance of camels for public health in this country. More than 900 published documents were systematically searched to find relevant studies from 1,890 until late 2018. The collected articles were classified according to the aetiological agents. In this study, 19 important zoonotic diseases were reported among Iranian camels including listeriosis, leptospirosis, plague, Q fever, brucellosis, campylobacteriosis, tuberculosis, pasteurellosis, clostridiosis, salmonellosis, Escherichia coli infections, rabies, camelpox, Middle East respiratory syndrome coronavirus, Crimean‐Congo haemorrhagic fever, echinococcosis, cryptosporidiosis, toxoplasmosis and dermatophytosis, most of which belong to bacterial, viral, parasitic and fungal pathogens, respectively. Results show that camels are one of the most important sources of infections and diseases in human; therefore, continuous monitoring and inspection programs are necessary to prevent the outbreak of zoonotic diseases caused by this animal in humans.

show abstract

Section: Escherichia Colimentioning

confidence: 99%

Zoonotic implications of camel diseases in Iran

Mohammadpour

Champour

Tuteja

et al. 2020

Veterinary Medicine & Sci

View full text Add to dashboard Cite

show abstract

“…Randomly chosen short primers (about 10 bp) are used to amplify DNA in the genome. This method makes it possible to obtain a larger number of products by reproducing unspecified fragments of template DNA [14], as well as the use of arbitrary primed PCR methods which has the same principle with RAPD that was used by Suardana et al [20] in identification of the diversity of Escherichia coli O157:H7.…”

Section: Discussionmentioning

confidence: 99%

Sensitivity of polymerase chain reaction in the detection of rat meat adulteration of beef meatballs in Indonesia

2020

View full text Add to dashboard Cite

Background and Aim: Meatballs are a processed product of animal origin that is consumed cooked, usually with chicken, beef, or pork as the main ingredient. Unfortunately, some unscrupulous sellers in Indonesia may adulterate this product with rat meat to decrease production costs. Rat meat in any food is a critical public health issue and is prohibited under Indonesian food safety laws, as well as within Muslim communities. This study aimed to test the sensitivity of the polymerase chain reaction (PCR) method in the detection of rat meat contained in processed, cooked beef meatballs. Materials and Methods: Beef meatballs were formulated with different concentrations of rat meat. Molecular detection of adulteration was initiated by DNA extraction of each cooked meatball formulation followed by PCR using a specific primer for mitochondrial DNA Cytochrome b gene of rat, which primer sequences, i.e., forward primer: 5'CATGGGGACGAGGACTATACTATG '3 and reverse primer: 5'GTAGTCCCAATGTAAGGGATAGCTG'3. Results: Our study showed that the PCR method is sensitive in detecting 5% or greater rat meat adulteration of cooked beef meatballs. Conclusion: The PCR method can be used to detect most rat meat adulteration of cooked beef meatballs and offers a sensitive and effective means to protect food safety and religious requirements in Indonesia.

show abstract

“…Isolates were cultured on lactose broth medium (LB) at 37°C, followed by incubation aerobically overnight, before which they were reconfirmed using E. coli O157 latex agglutination test (Oxoid, DR120M). [13][14][15]…”

Section: Cultivation Of E Coli O157:h7 Isolatesmentioning

confidence: 99%

Shiga-Like Toxin Produced by Local Isolates of Escherichia coli O157:H7 Induces Apoptosis of the T47 Breast Cancer Cell Line

Pinatih

Suardana

Widiasih

et al. 2021

Breast Cancer�(Auckl)

Self Cite

View full text Add to dashboard Cite

Purpose: It has been suggested that Shiga-like toxins produced by Escherichia coli O157:H7 could be used as novel therapeutic agents against malignant tumors. In addition, the antitumor potency of local isolates from Indonesia, which are known to be less toxic than the control isolate ATCC 43894, has not yet been tested. The study aimed to analyze local strains of E. coli O157:H7 as a proapoptosis agent on the T47 breast cancer cell line. Methods: As many as 30 culture cells of T47D breast cancer cell line were subjected to purified extracts of Shiga-like toxin originating from 5 local isolates of E. coli O157:H7: KL-48(2), SM-25(1), SM-7(1), DS-21(4), and 1 isolate ATCC 43894 which was used as a control. Toxin production of each isolate was detected using a sandwich enzyme-linked immunosorbent assay, and the treatment of cell lines was observed for 24 hours, with 2 replications; 3-(4,5-dimethylthiazolyl-2)-2,5-diphenyltetrazolium bromide tests and acridine orange/ethidium bromide double staining assays were used for detection and analyses of apoptosis. Results: The study showed 2 local strains of E. coli O157:H7 (codes KL-48(2) and SM-25(1)) had toxins positive at titer 5 and 10 μg/100 μL. These titers were lower than the control isolate ATCC 43894, but they had a necrosis effect higher ( P < .05), ie, 80.3%, than control isolate, ie, 63.3%. Other local strain SM-25(1) also had a good necrosis effect. It has a nondifferent necrosis effect ( P > .05) with the control isolate ATCC 43894, ie, 13.0% from 13.3%. Conclusion: This study concludes that the Shiga toxin produced by E. coli O157:H7 local isolate (Indonesia) has potential as a proapoptotic and/or necrotic agent for treating T47 breast cancer cell lines, as effectively as ATCC 43894 control isolates.

show abstract

Evaluation of zoonotic potency of Escherichia coli O157:H7 through arbitrarily primed PCR methods

Cited by 9 publications

References 32 publications

Zoonotic implications of camel diseases in Iran

Zoonotic implications of camel diseases in Iran

Sensitivity of polymerase chain reaction in the detection of rat meat adulteration of beef meatballs in Indonesia

Shiga-Like Toxin Produced by Local Isolates of Escherichia coli O157:H7 Induces Apoptosis of the T47 Breast Cancer Cell Line

Contact Info

Product

Resources

About