Identification of Salmonella Typhimurium-specific DNA aptamers developed using whole-cell SELEX and FACS analysis

Moon, Ji-Hea; Kim, Gi‐Young; Lee, Sang-Dae; Park, Saetbyeol

doi:10.1016/j.mimet.2013.08.005

Cited by 44 publications

(35 citation statements)

References 20 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…at ambient temperature for aptamers binding, (2) separating the bound and unbound ssDNA from target in centrifugation process, (3) amplification of the bounded ssDNA (in this process, ssDNA is concentrated by PCR-Ultracel), and (4) finally, ssDNAs are sorted, cloned, sequenced, and then individually characterized according to their binding affinity for Salmonella cells using flow cytometry. Through abovementioned process, a potential ligand aptamer (5′-ACGGGCGTGGGGGCAATGCT GCTTGTAG CCTTCCCCTGTGCGCG-3′) has been selected for capturing S. typhimurium (Moon et al 2013). Other aptamer candidates such as 5′-TATGGCGGCGTCAC C C G A C G G G A C T T G A C AT TAT G A C A G -3 ′ a n d GAGGAAAGTC TATAGCAGAGGAGATGTGTG AACCGAGTAA have also been selected after the seventh round of SELEX and exhibited low LOD of 10-40 cfu/mL.…”

Section: Salmonella Speciesmentioning

confidence: 99%

An Update on Aptamer-Based Multiplex System Approaches for the Detection of Common Foodborne Pathogens

et al. 2017

View full text Add to dashboard Cite

Foodborne ailments constitute a public health challenge and pose an incredible economic burden in healthcare system around the globe. This dilemma has urged authorities and other entities working in field of food quality control and supply chain to play a pivotal role in ensuring food safety. Analytical strategies have been developed using numerous systematic evolution of ligands by exponential enrichment (SELEX) methods to assure food safety. High-affinity and high-sensitivity ssDNA and RNA aptamers against pathogens have emerged as a novel strategy, as compared to the more resource-demanding and complicated biochemical test-based approaches. Thus, this review aims to focus on some methods used in the selection of specific bare, modified, and conjugated aptamers and on the further analysis of selected aptamers using flow cytometer or post-SELEX modifications for enhanced detection of frequently diagnosed foodborne bacteria such as Bacillus sp., Campylobacter jejuni, Escherichia sp., Salmonella sp., Staphylococcus aureus, Shigella sp., Listeria monocytogenes, and Streptococcus pyogenes and/or targeting their cell components towards attaining fast, sensitive, and selective methods for the detection of pathogens in food(s) or other sources.

show abstract

Section: Salmonella Speciesmentioning

confidence: 99%

An Update on Aptamer-Based Multiplex System Approaches for the Detection of Common Foodborne Pathogens

et al. 2017

View full text Add to dashboard Cite

show abstract

“…Although methods for microbial detection and control are well established, conventional detections are complicated and require multiple steps. Therefore, rapid detection of pathogen has been required and actively developed (Kim et al, 2009(Kim et al, , 2013Moon et al, 2013). Established methods include culture, biochemical tests, and immuno assay based methods.…”

Section: Selection and Analytical Applications Of Aptamers For The Dementioning

confidence: 99%

“…Thus, its success rate is about 50% (Mayer et al, 2010). To solve this problem, researchers has been suggesting a variety kinds of wholecell SELEX process, such as the optimization of PCR amplification, centrifugation for elution of oligonucleotides from cells, and concentration of eluted aptamer candidates (Moon et al, 2013).…”

Section: Whole-cell Selexmentioning

confidence: 99%

“…The aptamer, developed by whole cell SELEX with flow cytometry, has more sensitive and specific to target bacteria than antibody, according to its accessibility by chemical synthesis and ease of modifications. These advantages suggested that aptamers present a promising alternative to antibodies in the biosensor system (Moon et al, 2013). Therefore aptamers could compete with antibodies in whole cell SELEX with flow cytometry analysis.…”

Section: Flow Cytometry Analysis In the Whole Cell Selexmentioning

confidence: 99%

“…There is a high demand for specific ligands against the surface of target bacteria for basic research and monitoring (Cibiel et al, 2011). Antibodies are extensively developed and used as the cell surface biomarkers, but they are difficult to produce with similar specificity and binding affinity, and expensive to produce (Tombelli et al, 2005;Cibiel et al, 2011;Moon et al, 2013). Therefore, aptamers have been described as potent probes, rivaling antibodies.…”

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

The Importance of FACS Analysis in the Development of Aptamers Specific to Pathogens

Moon¹,

Kim²,

Park³

et al. 2014

Journal of Biosystems Engineering

Self Cite

View full text Add to dashboard Cite

Purpose: This review aims to introduce aptamers and the methods of its development to improve the sensitivity and selectivity to target bacteria. In this review, we have highlighted current developments and directions in the pathogen detection based on aptamers. Background: Aptamers, the specific nucleic acid sequences, can bind to targets with high affinity and specificity. Some of researches on the use of aptamers for the detection of pathogen have been reported in recent years. Aptamers have more applicability than antibodies for the development of pathogen detection using biosensor; such as easy to synthesis and labeling, lack of immunogenicity, and a low cost of production. However, only few reports on the development and use of aptamers for the detection of pathogen have been published. Review: Aptamers specific to pathogen are obtained by whole-cell systematic evolution of ligands by exponential enrichment (SELEX) process. SELEX process is composed of screening random oligonucleotide bound with target cells, multiple separation and amplification of nucleic acids, final identification of the best sequences. For improving those affinity and selectivity to target bacteria, optimization of multiple separating process to remove unbounded oligonucleotides from aptamer candidates and sorting process by flow cytometry are required.

show abstract

Aptamers: A prospective tool for infectious diseases diagnosis

Chen

Zhou

Peng

et al. 2022

Clinical Laboratory Analysis

View full text Add to dashboard Cite

It is well known that people's health is seriously threatened by various pathogens (such as Mycobacterium tuberculosis, Treponema pallidum, Novel coronavirus, HIV, Mucor, etc.), which leads to heavy socioeconomic burdens. Therefore, early and accurate pathogen diagnosis is essential for timely and effective therapies. Up to now, diagnosing human contagious diseases at molecule and nano levels is remarkably difficult owing to insufficient valid probes when it comes to determining the biological markers of pathogens. Aptamers are a set of high‐specificity and high‐sensitivity plastic oligonucleotides screened in vitro via the selective expansion of ligands by exponential enrichment (SELEX). With the advent of aptamer‐based technologies, their merits have aroused mounting academic interest. In recent years, as new detection and treatment tools, nucleic acid aptamers have been extensively utilized in the field of biomedicine, such as pathogen detection, new drug development, clinical diagnosis, nanotechnology, etc. However, the traditional SELEX method is cumbersome and has a long screening cycle, and it takes several months to screen out aptamers with high specificity. With the persistent development of SELEX‐based aptamer screening technologies, the application scenarios of aptamers have become more and more extensive. The present research briefly reviews the research progress of nucleic acid aptamers in the field of biomedicine, especially in the diagnosis of contagious diseases.

show abstract

Identification of Salmonella Typhimurium-specific DNA aptamers developed using whole-cell SELEX and FACS analysis

Cited by 44 publications

References 20 publications

An Update on Aptamer-Based Multiplex System Approaches for the Detection of Common Foodborne Pathogens

An Update on Aptamer-Based Multiplex System Approaches for the Detection of Common Foodborne Pathogens

The Importance of FACS Analysis in the Development of Aptamers Specific to Pathogens

Aptamers: A prospective tool for infectious diseases diagnosis

Contact Info

Product

Resources

About