In-silico Specificity Comparison between GMF-GMR and JMF-JMR Primers for Detecting moaC Genes of Food Spoilage Bacteria Pseudomonas spp

Ethica, Stalis Norma; Sulistyaningtyas, Ayu Rahmawati; Darmawati, Sri

doi:10.1088/1755-1315/292/1/012033

Cited by 5 publications

(8 citation statements)

References 12 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Next, the genotype feature related with genes associated with proteins underlining the unique phenotype was targeted. Primers were then designed from internal part of open reading frame of the targeted gene sequences using Primer3Plus (Ethica et al, 2013;2014;2019;Untergasser et al, 2007). Two pairs of primers that have the least possibility of hairpin formation, self-complementarity, and dimerization was selected (Ethica et al, 2017).…”

Section: Methodsmentioning

confidence: 99%

“…Two pairs of primers that have the least possibility of hairpin formation, self-complementarity, and dimerization was selected (Ethica et al, 2017). The newly designed primers were used as input for the web-based in silico PCR, which was run from http://insilico.ehu.es/PCR/ using all streptococcal genomes retrieved from its source of database (Bikandi et al, 2004;Ethica et al, 2019;San Millán et al, 2013). A sequence analysis was finally conducted by clicking DNA band appeared as PCR product in program output or using 'Amplify Show Result' tool.…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Streptolysin Encoding Genes sagC and sagD as Biomarkers of Fish Pathogen Streptococcus iniae: An In Silico Study

Ethica

Darmawati²,

Dewi³

et al. 2020

Squalen Bull. Marine Fisheries Postharvest Biotech.

View full text Add to dashboard Cite

Streptococcus iniae has been notorious as a serious tilapia fish pathogen leading to many disease outbreaks in warm water marine aquaculture. An in silico investigation about the potential of virulence genes of S. iniae, sagC and sagD, as biomarkers of the bacterial species, has been carried out. The aim was to determine bacterial biomarkers, which are important to facilitate early rapid diagnosis of S. iniae streptococcal infection in fish and also in humans. First, specific primers were designed from sagC and sagD genes of S. iniae SF1 genomic DNA using Primer3Plus. Next, in silico PCR (Polymerase Chain Reaction) analysis was carried out using the newly designed primers and 117 genomic DNA of streptococci (all species) retrieved from the database. Primers designed from sagC and sagD genes (SagCF: ‘5- TGCTGACCTCCTAAAAGGGC -3’ and SagCR: ‘5- CTATGCGGCGGGTTTAAGGT -3’ as well as SagDF: 5’- GCCAATCCAATCCTGTCATGC -3’ and SagDR: 5’- TGCAGCTTCCATAACCCCTC -3’) could result in a single band of each matching to 558-bp and 590-bp PCR products only from S. iniae. From 116 other streptococcal genomes studied using similar primers have resulted in no amplicon bands. A further check showed that the amplicons were truly part of sagC and sagD genes of S. iniae. These results showed that sagC and sagD genes appeared to be biomarkers of S. iniae, which are potential to be used to facilitate rapid diagnostic of the pathogenic bacterium.

show abstract

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Streptolysin Encoding Genes sagC and sagD as Biomarkers of Fish Pathogen Streptococcus iniae: An In Silico Study

Ethica

Darmawati²,

Dewi³

et al. 2020

Squalen Bull. Marine Fisheries Postharvest Biotech.

View full text Add to dashboard Cite

show abstract

“…Next, the genotype feature, such as genes associated with proteins underlining the unique phenotype was targeted. Primers were then designed from the internal part of open reading frame (ORF) of the targeted gene sequences in FASTA format as input using Primer3Plus at https://primer3plus.com/ (Untergasser et al, 2007;Ethica et al, 2013;Ethica, 2014;Ethica, Sulistyaningtyas, & Darmawati, 2019;Ethica, Darm awat i, Dewi, Nurrahman, & Sulistyaningtyas, 2020). The input of the program is basically a FASTA format of a gene of interest.…”

Section: Methodsmentioning

confidence: 99%

“…genomes stored in the program database. In silico PCR can be done by choosi ng "PCR Amplification" from the main page of the website, and once it opens, inserts the primers, then click "amplify" (Bikandi, Millán, Rementeria, & Garaizar, 2004; San Millán, Martínez-Ballesteros, Rementeria, Garaizar, & Bikandi, 2013); Ethica, Sulistyaningtyas, & Darmawati, 2019;Ethica, Darmawati, Dewi, Nurrahman, & Sulistyaningtyas, 2020). The nucleotide database used in the in silico PCR website comes from National Center of Bioinformatics Institute (NCBI) database.…”

Section: Methodsmentioning

confidence: 99%

Detection of rtxA Gene as a Biomarker of Seafood-Borne Pathogen Vibrio cholerae using In Silico PCR Assay

Ethica

Hidayati

Fuad

et al. 2020

Squalen Bull. Marine Fisheries Postharvest Biotech.

View full text Add to dashboard Cite

Seafood-borne outbreaks caused by Vibrio cholerae have led to the increased need for food safety risk assessment of marine products. An in silico investigation about the potential of virulence gene of V. cholerae, rtxA, as a DNA biomarker of the toxigenic bacterium has been carried out. The aim of this study was to use the bacterial DNA biomarker sequence as a tool to facilitate early rapid detection of cholera infection. Five specific pairs of primers were designed from the rtxA open reading frame DNA of V. cholerae O1 biovar El Tor str. N16961 genomic DNA using Primer3Plus. Next, in silico Polymerase Chain Reaction (PCR) assay was carried out using the newly designed primers and 25 genomic DNA of vibrio spp. retrieved from the in silico database. One of the five designed pairs of primers, RtxAOF-RtxAOR: ‘5-CGCAAAACAGTTTCAGCCGA-3’ and 5’-AGGTTGGTCTTTTGTGGCCA-3’, could result in single DNA amplicon sized 518 bp only from V. cholerae species. No amplicon bands were produced from 17 other vibrio genomes studied using similar RtxAF-RtxAR primers. A further check showed that the amplicon was indeed part of the rtxA gene of V. cholerae. Based on this in silico study, rtxA gene appeared to be a DNA biomarker of V. cholerae, which is potential to facilitate rapid diagnosis of the virulence bacterium using in silico PCR assay.

show abstract

“…Primer spesifik dibuat dari sekuen DNA yang telah diketahui urutannya. Primer spesifik dapat dirancang untuk mengamplifikasi gen tertentu, yang memberikan peluang lebih besar untuk mendapatkan hasil PCR yang baik sesuai target (Ethica et al, 2019). Sekuen primer yang spesifik akan mampu memberikan efek besar pada spesifisitas dan sensitivitas reaksi (Ethica et al, 2019) (Ye et al, 2012).…”

Section: Pendahuluanunclassified

DESAIN PRIMER SECARA IN SILICO UNTUK AMPLIFIKASI GEN tcdA BAKTERI CLOSTRIDIUM DEFFILCILE

Dewi,

Octifani

2023

JALM

View full text Add to dashboard Cite

Antibiotics are drugs used to fight infections caused by bacteria. C. difficile bacteria is a bacterium that causes Clostridium difficile infection (ICD). Toxin A of C. difficile bacteria is exotoxin A (tcdA) which is a virulence factor that causes disease. Toxin A can damage the intestinal mucosa and cause bleeding. The cost of examining and treating patients with AAD and PMC is very high, so the dosage must be determined correctly. Laboratory tests function to determine the presence or absence of an ICD. The discovery of specific biomarkers is a discovery priority to improve the quality of laboratory tests. Specific primary design is an important step in all types of laboratory examination methods, one of which is molecular examination by PCR. The primary design must have specific properties so as to be efficient at target amplification. This study aims to obtain a primer design that can be used to limit the amplification area of the TcdA gene in silico. This study used a literature study from the NCBI genbank to obtain the tcdA gene sequence of C. defficile bacteria with accession number DQ902560.1. The tcdA gene sequence of C. difficile bacteria was analyzed using Primer3Plus to determine whether there is hairpin and dimer formation. Furthermore, identification was carried out using web-based in silico PCR to determine the number of amplicon and visualization on the electrophoretic gel. The level of tcdA gene homology in the species group in the BLAST test. The results showed that the best primer design for in silico detection of the tcdA gene of C. difficile was the forward primer 5'-GCAGATGCCAAGAGACACAC-3' and the reverse primer 3'-GCAGATGCCAAGACACACAC-5'. The primary design is able to amplify the tcdA gene region with a size of 247 amplicons.

show abstract

In-silico Specificity Comparison between GMF-GMR and JMF-JMR Primers for Detecting moaC Genes of Food Spoilage Bacteria Pseudomonas spp

Cited by 5 publications

References 12 publications

Streptolysin Encoding Genes sagC and sagD as Biomarkers of Fish Pathogen Streptococcus iniae: An In Silico Study

Streptolysin Encoding Genes sagC and sagD as Biomarkers of Fish Pathogen Streptococcus iniae: An In Silico Study

Detection of rtxA Gene as a Biomarker of Seafood-Borne Pathogen Vibrio cholerae using In Silico PCR Assay

DESAIN PRIMER SECARA IN SILICO UNTUK AMPLIFIKASI GEN tcdA BAKTERI CLOSTRIDIUM DEFFILCILE

Contact Info

Product

Resources

About