MDR-1 Gene 1199 Variant Primer Design Techniques in Pediatric Patient  Buffy Coat Samples With Lla

Yustinadewi, Putu Desy; Yustiantara, Putu Sanna; Narayani, Inna

doi:10.24843/metamorfosa.2018.v05.i01.p16

Cited by 16 publications

(21 citation statements)

References 4 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…A TM that is too low will result in the attachment of the primer to the template being non-specific. At the same time, if it is too high, it will result in an inefficient PCR product because the primer and template DNA are difficult to bind to each other [11]. This is also in line with the statement by Solanki [12] that a TM that is too low can allow the primer to attach elsewhere and produce non-specific PCR products.…”

Section: Primer Designsupporting

confidence: 68%

Optimization of annealing temperature for amplification of the exon one region of the HPPD gene in HA1 accession sunflowers

Yunita

Rosadi

Jamsari

et al. 2023

IOP Conf. Ser.: Earth Environ. Sci.

View full text Add to dashboard Cite

The HPPD gene is one of the genes that is actively involved in the biosynthesis of tocopherol, which is the main component of Vitamin E. Sunflower is raw materials for natural medicine since their oil contains vitamin E. To obtain complete information regarding the whole sequences of the 4-Hydroxyphenylpyruvate Dioxygenase (HPPD) gene in sunflower accession HA1, the exon one region needs to be identified using a PCR-based method. One factor affecting the success rate of PCR is the annealing temperature. The optimum annealing temperature will produce specific target gene products. This study aimed to determine the optimal temperature for amplifying the exon 1 region of the HPPD gene using the PCR method. This research began with primer design activities, followed by in vitro amplification (PCR), then optimization of annealing temperature using gradient PCR. The results showed that the optimum temperature for amplifying fragment one was an annealing temperature of 53 °C, fragment two was at an annealing temperature of 45 °C, and fragment three had an annealing temperature of 57 °C with the expected size of PCR products are 306 bp, 506 bp, and 534 bp respectively.

show abstract

Section: Primer Designsupporting

confidence: 68%

Optimization of annealing temperature for amplification of the exon one region of the HPPD gene in HA1 accession sunflowers

Yunita

Rosadi

Jamsari

et al. 2023

IOP Conf. Ser.: Earth Environ. Sci.

View full text Add to dashboard Cite

show abstract

“…The initial stage of PCR amplification is to analyze the purity and concentration of DNA, where the minimum requirement for DNA purity is 1-2 (ideally 1.8-2). Meanwhile, the concentration of DNA for DNA profiling is 20 g/ml [20]. In this study, the results of DNA purity by nanodrop from existing samples showed between 1,069 g/µl and 1,265 g/µl (data not shown), so that the DNA purity requirements to proceed to the PCR amplification stage were met so that it could be used in identification.…”

Section: Pcr Amplificationmentioning

confidence: 73%

Molecular Detection of Eimeria Zuernii in Cattle in Malang, East Java, Indonesia by Nested-PCR

Ekawasti¹,

Wardhana²,

Nepho³

et al. 2023

Proceedings of the 1st International Conference for Health Research – BRIN (ICHR 2022)

View full text Add to dashboard Cite

Coccidiosis continues to be one of the most important issues in animal health and generates significant economic losses to the livestock industry in Indonesia, specifically due to Eimeria spp. Infections. Eimeria are specific to a particular host Eimeria and multi-species infections are more prevalent than infections with only one species. Eimeria zuernii is one of the highly pathogenic coccidia that is a major cause of clinical eimeriosis in livestock. This study's objective was to identify E. zuernii infections in Malang, East Java, Indonesian farms. The oocysts were concentrated and purified using a fecal harvesting method. The genomic DNA is extracted according to the instructions included with the kit. Internal transcribed spacer-1 (ITS1) nested polymerase chain reaction (nPCR) was used to analyze a total of 102 stool samples. Primer pairs specific to E. zuernii, as well as a standard optimum annealing temperature of 55 °C for the species, were discovered. The samples were amplified DNA approximately 334 bp. The results indicated that the prevalence of Eimeria spp. Was57.8% (59/102) by floatation method and specific species, E. zuernii was 35.3% (36/102) by nPCR of cattle fecal samples in Malang, East Java. When Eimeria species are available, the parasite spreads widely through the group inside a couple of life cycles. A pathogenic Eimeria species can infect cattle, thus species identification is critical. Low-infective portions of highly pathogenic species can cause illness, and the productive idea of the parasite quickly prompts high re-contamination. To increase cattle production, eimeriosis management should be considered.

show abstract

“…If the temperature of Ta is high, then the primer and DNA template are difficult to bind so that it will produce a low (less efficient) PCR product. However, if Ta is too low, it will cause the primer attachment process to be on a non-specific template [19]. Based on the data analysis, all tables indicate that all primary candidates are included in the criteria.…”

Section: Resultsmentioning

confidence: 99%

Primer Design and Analysis for Detection of mecA gene

Syamsidi

Aanisah

Fiqram³

et al. 2021

J. Trop. Pharm. Chem.

View full text Add to dashboard Cite

MecA is a gene that causes antibiotic resistance and it contained in Staphylococcus aureus. The gene can be detected using pairs of primer (forward and reverse). Primes is short nucleotide that are used as attachment point for DNA polymerase and as a barrier for the fragment DNA target to be amplified with Polymerase Chain Reaction (PCR). The aims of this study were to design and analysis the nucleotide primer sequences of MecA. This research using in silico method of NCBI (National Center of Biotechnology Information) application, clone manager10, oligoanalyzer3.1, perlprimer and primer3plus. The results of design and candidate primer analysis showed that the first candidate of forward and reverse primer that falls with in the criteria with base sequences 18-30, 40-60 GC%, Tm 50-60, 3’ dimer ≤3, stability ≥1,2, secondary structure >-16 Kcal/mol, runs ≤5, repeats ≤4, hairpins>-3 Kcal/mol. The conclusion is the first candidate of forward primer with 19 base pair (5’GTGAAGCAACCATCGTTAC'3), %GC 47Tm 58oC, 3’dimer 2, stability 1.6, secondary structure -1,95 dan -3,61 Kcal/mol, runs 2, hairpins -0,1 start 53844 and the first candidate of reverse primer with 21 base pair (5’CCTTCTACACCTCCATATCAC'3), %GC 47, Tm 58oC, 3’dimer 0, stability 1.3, secondary structure -4,74 dan -5,38 Kcal/mol, runs 2, hairpins -2.5 dan start 55852. The both of primer can be use for identification of MecA gene by PCR method

show abstract

MDR-1 Gene 1199 Variant Primer Design Techniques in Pediatric Patient Buffy Coat Samples With Lla

Cited by 16 publications

References 4 publications

Optimization of annealing temperature for amplification of the exon one region of the HPPD gene in HA1 accession sunflowers

Optimization of annealing temperature for amplification of the exon one region of the HPPD gene in HA1 accession sunflowers

Molecular Detection of Eimeria Zuernii in Cattle in Malang, East Java, Indonesia by Nested-PCR

Primer Design and Analysis for Detection of mecA gene

Contact Info

Product

Resources

About