Replicon Typing of Plasmids Encoding Resistance to Newer β-Lactams

Carattoli, Alessandra; Miriagou, Vivì; Bertini, Alessia; Loli, A.; Colinon, Céline; Villa, Laura; Whichard, Jean M.; Rossolini, Gian María

doi:10.3201/eid1207.051555

Cited by 137 publications

(105 citation statements)

References 15 publications

Supporting

Mentioning

103

Contrasting

Order By: Relevance

“…This group of plasmids is regarded as a considerable public health threat due to its ability to spread across taxonomic borders (8,20,29,34,44,45). In this study, we present the complete plasmid sequence of pRA1 and provide new insights into the evolution of MDR IncA/C plasmids that allow for a better understanding of the underlying principles of plasmid propagation.…”

Section: Discussionmentioning

confidence: 99%

Comparative Genomics of the IncA/C Multidrug Resistance Plasmid Family

et al. 2009

View full text Add to dashboard Cite

Multidrug resistance (MDR) plasmids belonging to the IncA/C plasmid family are widely distributed among Salmonella and other enterobacterial isolates from agricultural sources and have, at least once, also been identified in a drug-resistant Yersinia pestis isolate (IP275) from Madagascar. Here, we present the complete plasmid sequences of the IncA/C reference plasmid pRA1 (143,963 bp), isolated in 1971 from the fish pathogen Aeromonas hydrophila, and of the cryptic IncA/C plasmid pRAx (49,763 bp), isolated from Escherichia coli transconjugant D7-3, which was obtained through pRA1 transfer in 1980. Using comparative sequence analysis of pRA1 and pRAx with recent members of the IncA/C plasmid family, we show that both plasmids provide novel insights into the evolution of the IncA/C MDR plasmid family and the minimal machinery necessary for stable IncA/C plasmid maintenance. Our results indicate that recent members of the IncA/C plasmid family evolved from a common ancestor, similar in composition to pRA1, through stepwise integration of horizontally acquired resistance gene arrays into a conserved plasmid backbone. Phylogenetic comparisons predict type IV secretion-like conjugative transfer operons encoded on the shared plasmid backbones to be closely related to a group of integrating conjugative elements, which use conjugative transfer for horizontal propagation but stably integrate into the host chromosome during vegetative growth. A hipAB toxin-antitoxin gene cluster found on pRA1, which in Escherichia coli is involved in the formation of persister cell subpopulations, suggests persistence as an early broad-spectrum antimicrobial resistance mechanism in the evolution of IncA/C resistance plasmids.

show abstract

Section: Discussionmentioning

confidence: 99%

Comparative Genomics of the IncA/C Multidrug Resistance Plasmid Family

et al. 2009

View full text Add to dashboard Cite

show abstract

“…Different ␤-lactamase profiles or mating abilities suggested that the A/C-type plasmids with bla SHV-2/SHV-5 genes varied in K. pneumoniae isolates of different PFGE types (B, C, and D). Links between replicon A/C and bla SHV genes and between replicon FII and bla SHV-12 were reported before (8,31). The FII replicon was predominant in E. coli with CTX-M-15 ESBL and has been identified in isolates of three PFGE types (c, d, and e).…”

mentioning

confidence: 85%

International Clones of Klebsiella pneumoniae and Escherichia coli with Extended-Spectrum β-Lactamases in a Czech Hospital

Hrabák

Empel²,

Bergerová

et al. 2009

J Clin Microbiol

View full text Add to dashboard Cite

A 2-month survey of extended-spectrum ␤-lactamase (ESBL) producers was performed in a Czech hospital. Klebsiella pneumoniae produced SHV-2, -5, or -12, Escherichia coli produced CTX-M-9 or -15, and other species produced TEM-92 or -132. All K. pneumoniae and E. coli isolates belonged to sequence types (STs) or clonal complexes (CCs) spread across the world (K. pneumoniae clonal complex 11 [CC11], CC14, and sequence type 101 [ST101] and E. coli CC31, CC73, CC131, and CC405) and carried various plasmids (mainly with A/C-and FII-type replicons).

show abstract

“…Transformants were checked by PCR for carriage of the CTX-M type 1 gene. Plasmids were restricted using EcoR1, their sizes were assessed (2), and they were typed according to the method described by Carattoli et al (6). Initially, multiplex PCR was used and then refined, with single PCR used to obtain clear amplicons for sequencing.…”

mentioning

confidence: 99%

“…Once transconjugates were confirmed, they were randomly selected, and plasmids were isolated as described previously. Multiplex PCR was undertaken to determine the plasmid Inc/ rep type, followed by simplex PCR as previously described (6,11). In one isolate (Table 1, (Table 1).…”

mentioning

confidence: 99%

Dissemination of CTX-M-15 β-Lactamase Genes Carried on Inc FI and FII Plasmids among Clinical Isolates of Escherichia coli in a University Hospital in Istanbul, Turkey

et al. 2008

Self Cite

View full text Add to dashboard Cite

The CTX-M-1 group was found in 86.8% of the Escherichia coli isolates from Istanbul. A subset study revealed all isolates carrying bla CTX-M-15 genes flanked by the insertion element ISEcp1. Plasmid typing of transconjugates carrying bla CTX-M-15 showed that most isolates belonged to the Inc/rep FII group but that one isolate also belonged to the FI group.CTX-M-type enzymes were reported in Germany and Argentina in 1989, and so far, more than 67 CTX-M-type ␤-lactamases have been identified, mostly in Escherichia coli, Klebsiella pneumoniae, and Salmonella enterica serovar Typhimurium isolates (http://www.lahey.org). The global spread is now a major concern in certain areas such as Latin America, Asia, Europe, Africa, and North America (5).Data on the prevalence and distribution of CTX-M-type enzymes are very limited in Turkey. Two studies revealed that CTX-M enzymes were present and disseminated among Enterobacteriaceae family isolates in Turkey (1, 10). The aim of this study was to determine the current prevalence of the CTX-M-1 group and the molecular characteristics in E. coli clinical isolates in a university hospital in Istanbul, Turkey.(This work was presented in part as a poster at the "Microbes in a Changing World" Congress of the International Union of Microbiological Societies (IUMS), San Francisco, CA, 23 to 28 July 2005.)A total of 1,010 consecutive nonrepetitive isolates of E. coli obtained from inpatients and outpatients at the hospital of Istanbul Faculty of Medicine over a 2-year period (2002 to 2004) were screened for extended-spectrum ␤-lactamase (ESBL) production, using the double-disc synergy test. A total of 61 E. coli isolates (27 from inpatients and 34 from outpatients) with ESBL phenotypes were included in this study, the majority of which were from the urine and respiratory specimens of patients treated in six different medical and surgical wards.MICs were determined by the agar dilution method. MICs for cefotaxime, ceftriaxone, and ceftazidime used alone and in combination were determined, with 4 g/ml clavulanic acid for phenotypic detection of ESBLs.Conjugation experiments for the transfer of cefotaxime resistance were carried out with all CTX-M-1-producing E. coli isolates (8). Crude extracts of ␤-lactamases were subjected to isoelectric focusing (IEF) (3).All isolates were screened for the CTX-M-1 group (13) and bla TEM (16) and bla SHV (9). Strains which had pI bands at 7.3 were subjected to bla OXA-1 -like PCR using the primers OXA-1-A (5Ј-GAATCGCATTATCACTTATGG-3Ј) and OXA-1-B (5Ј-GATACATGTTCTCTATGG-3Ј; this study). PCR amplicons for linking ISEcp1 with bla CTX-M were obtained by anchoring one primer at the 3Ј end of bla CTX-M (bla CTX-M reverse, 5ЈCACTTTGTCGTCTAAGGCG3Ј) and the other to the 5Ј end of ISEcp1 (5ЈAATACTACCTTGGCTTTCTGA3Ј).Sequencing was carried out with both strands by using the dideoxy chain termination method with a Perkin Elmer Biosystems 377 DNA sequencer. Sequence analysis was performed using a Lasergene DNASTAR software package. Sequence alignments were done u...

show abstract

Replicon Typing of Plasmids Encoding Resistance to Newer β-Lactams

Cited by 137 publications

References 15 publications

Comparative Genomics of the IncA/C Multidrug Resistance Plasmid Family

Comparative Genomics of the IncA/C Multidrug Resistance Plasmid Family

International Clones of Klebsiella pneumoniae and Escherichia coli with Extended-Spectrum β-Lactamases in a Czech Hospital

Dissemination of CTX-M-15 β-Lactamase Genes Carried on Inc FI and FII Plasmids among Clinical Isolates of Escherichia coli in a University Hospital in Istanbul, Turkey

Contact Info

Product

Resources

About