Systematic Analysis of the Amino Acid Residues of Human Papillomavirus Type 16 E7 Conserved Region 3 Involved in Dimerization and Transformation

Abstract

The human papillomavirus (HPV) E7 oncoprotein exists as a dimer and acts by binding to many cellular factors, preventing or retargeting their function and thereby making the infected cell conducive for viral replication. Dimerization of E7 is attributed primarily to the C-terminal domain, referred to as conserved region 3 (CR3). CR3 is highly structured and is necessary for E7's transformation ability. It is also required for binding of numerous E7 cellular targets. To systematically analyze the molecular mechanisms by which HPV16 E7 CR3 contributes to carcinogenesis, we created a comprehensive panel of mutations in residues predicted to be exposed on the surface of CR3. We analyzed our novel collection of mutants, as well as mutants targeting predicted hydrophobic core residues of the dimer, for the ability to dimerize. The same set of mutants was also assessed functionally for transformation capability in a baby rat kidney cell assay in conjugation with activated ras. We show that some mutants of HPV16 E7 CR3 failed to dimerize yet were still able to transform baby rat kidney cells. Our results identify several novel E7 mutants that abrogate transformation and also indicate that E7 does not need to exist as a stable dimer in order to transform cells.More than 100 human papillomavirus (HPV) types have been described, and more are presumed to exist (16). HPVs induce papillomas in the cutaneous and mucosal epithelia, where specific HPV types often preferentially infect distinct anatomical sites. HPVs associated with lesions that can progress to carcinogenesis are classified as "high-risk" types, the most common of which is HPV16. In contrast, HPVs associated with benign warts that regress with time are termed "lowrisk" viruses (50). Persistent infection by high-risk HPVs is associated with 99.7% of all human cervical cancer cases (15), other genitourinary cancers, and an increasingly growing number of oral cancers (21).The viral E6 and E7 oncoproteins are consistently expressed in HPV-induced cancers and are necessary to maintain malignant cell growth (3,6,29,42,43). Repression of their transcription by reexpression of the viral E2 protein induces rapid growth arrest and senescence of cervical cancer cells (22,23). The HPV E7 oncoprotein binds the product of the retinoblastoma susceptibility locus (pRb) and the related family members p107 and p130 (17). These proteins function as tumor suppressors, maintaining control of the G 1 /S checkpoint of the cell cycle by binding to the E2F family of transcription factors and by recruiting transcriptional repressor complexes to the E2F-responsive genes (10, 36). Besides pRb, the E7 oncoproteins from high-risk HPV types abrogate the inhibitory activities of the cyclin-dependent kinase inhibitors p21 and p27 by directly binding these factors (19,48). E7 interacts with the pCAF acetyltransferase, the Mi2␤ subunit of the NuRD histone deacetylase complex, the S4 component of the 26S proteasome, the HIF-1␣ and E2F6 transcription factors, and many other important cellular protei...

Conserved Region 3 of Human Papillomavirus 16 E7 Contributes to Deregulation of the Retinoblastoma Tumor Suppressor

“…1). Unlike previous work, we avoided using deletion mutants or mutants which target highly conserved, structurally important hydrophobic residues of E7 CR3 (52). This approach allowed us to examine the role of each individual residue on the surface of CR3 in deregulating pRb function.…”

“…6B). It should be noted that for the yeast two-hybrid analysis, CR3 mutants were previously assessed for any autoactivation potential (52). Although R66E had greatly increased pRb binding potential in the yeast two-hybrid analysis, this was not due to enhanced autoactivation.…”

“…These have been previously described by our group (52). Briefly, these mutations target residues whose side chains are predicted to be at least 25% surface exposed but not those that would participate in stabilizing the structural features of E7 (40,45,52). Hence, these mutations were constructed with the dual aims of preserving the structure of the CR3 region while disrupting the interaction surfaces available for cellular targets.…”

“…The surface-exposed mutants of E7 were previously generated by site-directed mutagenesis, and their construction has been described (52). For pRb degradation assays, E7 mutations were subcloned into the BamHI and XhoI restriction sites of a modified pCMV-Neo-Bam mammalian expression vector.…”

“…For degradation assays carried out in H1299 cells, full-length E7 mutants were subcloned into the pCMV-Neo-Bam expression vector with a tandem N-terminal flag-hemagglutinin tag using BamHI and XhoI restriction sites. For expression in yeast, full-length E7 was cloned into a modified pJG4-5ϩ vector (Clontech) using EcoRI and SalI or XhoI sites (52) or, in the case of the HPV16 E7 CR3 region, using PvuII and XhoI. HPV6, HPV11, and HPV18 CR3 regions were PCR amplified using the following primers: HPV6-F, CG AATTCCGAAGTGGACGGACAAGATTCA; HPV6-R, GATCCTCGAG TTAGGTCTTCGGTGCGCAG; HPV11-F, CGAATTCAAGGTGGACAA ACAAGACGCA; HPV11-R, TATGTCGACTTATGGTTTTGGTGCGCA GATGGG; HPV18-F, CGAATTCGATGGAGTTAATCATCAACAT; and HPV18-R, CCGCTCGAGTTACTGCTGGGATGC.…”