Triptolide in the treatment of psoriasis and other immune‐mediated inflammatory diseases

Han, Rui; Rostami-Yazdi, Martin; Gerdes, Sascha; Mrowietz, Ulrich

doi:10.1111/j.1365-2125.2012.04221.x

Cited by 139 publications

(118 citation statements)

References 56 publications

Supporting

Mentioning

115

Contrasting

Unclassified

Order By: Relevance

“…It has previously been used as a treatment for leprosy and rheumatoid arthritis and exhibits strong pharmacological activity with anti-inflammatory, anti-fertility and immunomodulatory effects (38,39). In the present study, the role of triptolide in osteoblast differentiation was investigated.…”

Section: Discussionmentioning

confidence: 99%

Triptolide inhibits the function of TNF-α in osteoblast differentiation by inhibiting the NF-κB signaling pathway

Liu

Wang

et al. 2017

Experimental and Therapeutic Medicine

View full text Add to dashboard Cite

Abstract. Chronic inflammation often delays fracture healing or leads to bone nonunion. Effectively suppressing pathological inflammation is crucial for fracture healing or bone remodeling. Triptolide, which is a diterpenoid epoxide, is the major active component of the Thunder God Vine, Tripterygium wilfordii. The aim of the present study was to investigate the role of triptolide in osteoblast differentiation and explore the molecular mechanisms of triptolide in fracture healing. Alkaline phosphatase (ALP) activity was used to evaluate osteoblast differentiation. ALP activity was measured via histochemical staining and western blotting was used to determine the expression of factors associated with inflammation. C2C12 cells were initially treated with 200 ng/ml bone morphogenetic protein (BMP)-2 alone for 3 days, which caused a significant increase in ALP activity (P<0.01). However, treatment with tumor necrosis factor (TNF)-α significantly decreased the ALP activity (P<0.05). Notably, treatment with the chronic inflammatory cytokine TNF-α significantly decreased the effect of BMP-2 in C2C12 cells compared with BMP-2 treatment alone (P<0.01). C2C12 cells were treated with increasing concentrations of BMP-2 or TNF-α for 3 days. The results demonstrated that TNF-α treatment significantly inhibited BMP-2-induced osteoblast differentiation in a dose-dependent manner (P<0.01). The role of triptolide in BMP-2-induced osteoblast differentiation was also examined. Cells were treated with BMP-2, BMP-2 + TNF-α alone, or BMP2 + TNF-α with increasing concentrations of triptolide (4, 8 or 16 ng/ml). After 3 days, the results of ALP activity revealed that triptolide significantly reversed the TNF-α-associated inhibition of osteoblast differentiation (P<0.01). Western blotting analysis demonstrated that triptolide markedly inhibited the phosphorylation of nuclear factor-κB, therefore suppressing the effects of TNF-α. In summary, triptolide is able to reverse the TNF-α-associated suppression of osteoblast differentiation, suggesting that triptolide treatment may have a positive effect on bone remodeling and fracture repairing.

show abstract

Section: Discussionmentioning

confidence: 99%

Triptolide inhibits the function of TNF-α in osteoblast differentiation by inhibiting the NF-κB signaling pathway

Liu

Wang

et al. 2017

Experimental and Therapeutic Medicine

View full text Add to dashboard Cite

show abstract

“…7 Ninetyfive percent of the active components of TwHF are diterpenes, triterpenes and alkaloids. Many diterpenes and triterpenes compounds isolated from TwHF exhibit anti-inflammatory and immunosuppressive activities.…”

mentioning

confidence: 99%

Modulation of IL-37 expression by triptolide and triptonide in THP-1 cells

Liang

Zhao

et al. 2014

Cell Mol Immunol

View full text Add to dashboard Cite

IL-37 is an anti-inflammatory cytokine that was only recently identified, and it is highly expressed in tissues from patients with inflammatory and autoimmune diseases. Inflammatory cytokines and inflammatory stimuli can induce the upregulation of IL-37. However, it has not been reported whether anti-inflammatory medications induce the expression of IL-37. In this work, we uncovered, for the first time, that two main bioactive components, triptolide and triptonide, from the herb Tripterygium wilfordii Hook f. (TwHF), which possess anti-inflammatory activity, upregulate the expression of IL-37, and this expression was suppressed by ERK1/2 and p38 MAPK inhibitors. Overall, our research demonstrated, for the first time, that anti-inflammatory active components (triptolide and triptonide) upregulated the expression of IL-37 most likely via activation of the ERK1/2 and p38 MAPK pathways. Keywords: IL-37; THP-1 cells; Tripterygium wilfordii Hook F.; triptolide; triptonide IL-37 is a newly defined member of the IL-1 cytokine family, which is a fundamental inhibitor of innate immunity. 1 IL-37 mRNA and protein have been detected in inflammatory and autoimmune diseases such as rheumatoid arthritis, 1 atopic dermatitis, 2 inflammatory bowel disease 3 and systemic lupus erythematosus. 4 IL-37 is endogenously kept at low levels in human cells, and can be upregulated by pro-inflammatory cytokines and inflammation stimuli. 1 However, it is still unclear whether anti-inflammatory medications induce the expression of IL-37. We document here, for the first time, that IL-37 was upregulated in THP-1 cells induced by two active components, triptolide and triptonide, extracted from the herb Tripterygium wilfordii Hook F (TwHF).In this study, THP-1-derived macrophages were used as a model system. 5 THP-1 cells were treated with five active monomer components (triptolide, triptonide, triptophenolide, celastrol and wilforlide A (Beijing Medicass Biotechnol, Beijing, China)) with purity of more than 98% at different concentrations (1, 5, 10 and 20 ng/ml) for various incubation periods (1, 6, 12 and 18 h). The expression of IL-37 mRNA was analyzed by real-time quantitative PCR using SYBR Premix Ex Taq kit (TaKaRa, Dalian, China) on the ABI prism 7700 Sequence Detection System (Perkin Elmer, Foster City, CA, USA). The sequences of the primers were as follows: IL-37-F (TTAGAAGACCCGGCTGGAAGCC) and IL-37-R (AGATCT-CTGGGCGTATGTAGT); GAPDH-F (ACCCAGAAGACTGT-GGATGG) and GAPDH-R (TTCTAGACGGCAGGTCAGGT). The expression of the target gene is presented as a ratio, which was normalized to the endogenous reference gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and the comparative CT method was used as reported in the literature. 6 The chemical structure of triptolide and triptonide are shown in Figure 1a. The results showed that triptolide and triptonide upregulated the expression of IL-37 mRNA (Figure 1b and c). As shown in Figure 1b, triptolide at concentrations of 5, 10 and 20 ng/ml was found to upregulate IL-37 mRNA, and the maximum upregu...

show abstract

“…TP was demonstrated to be effective for the treatment of rheumatoid arthritis (RA), systemic lupus erythematosus, systemic sclerosis, dermatomyositis, and other immunemediated inflammatory diseases. 2,3 During the past 3 decades, thousands of patients with various autoimmune and inflammatory diseases have been treated with TP or Tripterygium wilfordii Hook F in clinical trials in People's Republic of China.…”

Section: Introductionmentioning

confidence: 99%

Fabrication of novel vesicles of triptolide for antirheumatoid activity with reduced toxicity in vitro and in vivo

Zhang

Wang

et al. 2016

IJN

View full text Add to dashboard Cite

Triptolide (TP) displays a strong immunosuppression function in immune-mediated diseases, especially in the treatment of rheumatoid arthritis. However, in addition to its medical and health-related functions, TP also exhibits diverse pharmacological side effects, for instance, liver and kidney toxicity and myelosuppression. In order to reduce the side effects, a nano drug carrier system (γ-PGA- l -PAE-TP [PPT]), in which TP was loaded by a poly-γ-glutamic acid-grafted l -phenylalanine ethylester copolymer, was developed. PPT was characterized by photon scattering correlation spectroscopy and transmission electron microscopy, which demonstrated that the average diameter of the drug carrier system is 98±15 nm, the polydispersity index is 0.18, the zeta potential is −35 mV, and the TP encapsulation efficiency is 48.6% with a controlled release manner. The methylthiazolyldiphenyl-tetrazolium bromide assay and flow cytometry revealed that PPT could decrease toxicity and apoptosis induced by free TP on RAW264.7 cells, respectively. The detection of reactive oxygen species showed that PPT could decrease the cellular reactive oxygen species induced by TP. Compared with the free TP-treated group, PPT improved the survival rate of the mice ( P <0.01) and had no side effects or toxic effects on the thymus index ( P >0.05) and spleen index ( P >0.05). The blood biochemical indexes revealed that PPT did not cause much damage to the kidney (blood urea nitrogen and creatinine), liver (serum alanine aminotransferase and aspartate aminotransferase), or blood cells ( P >0.05). Meanwhile, hematoxylin and eosin staining and terminal-deoxynucleotidyl transferase dUTP nick-end labeling staining indicated that PPT reduced the damage of free TP on the liver, kidney, and spleen. Our results demonstrated that PPT reduced free TP toxicity in vitro and in vivo and that it is a promising fundamental drug delivery system for rheumatoid arthritis treatment.

show abstract

Triptolide in the treatment of psoriasis and other immune‐mediated inflammatory diseases

Cited by 139 publications

References 56 publications

Triptolide inhibits the function of TNF-α in osteoblast differentiation by inhibiting the NF-κB signaling pathway

Triptolide inhibits the function of TNF-α in osteoblast differentiation by inhibiting the NF-κB signaling pathway

Modulation of IL-37 expression by triptolide and triptonide in THP-1 cells

Fabrication of novel vesicles of triptolide for antirheumatoid activity with reduced toxicity in vitro and in vivo

Contact Info

Product

Resources

About