Yellowing disease of tomatoes caused by Tomato infectious chlorosis virus newly recognized in Japan

Hartono, Slamet; Natsuaki, Tomohide; Sayama, H.; Atarashi, H.; Okuda, Shigenobu

doi:10.1007/s10327-002-0015-x

Cited by 21 publications

(18 citation statements)

References 9 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…The nucleotide sequence of the RT-PCR products from three samples showed high identity (99-100%) to ToCV isolates from Florida (accession AY903448; Wintermantel et al 2005), Spain (DQ136146; Lozano et al 2006) and Greece (EU284744; Kataya et al 2008). On the other hand, the sequence had only 57% identity to that of TICV of Japan (Hartono et al 2003), suggesting that the virus detected in this study is very close to ToCV. To sequence the HSP70h, coat protein (CP) and minor coat protein (CPm) genes, we designed five primer sets, based on published ToCV nucleotide sequences (HSP-1F: GTTAAC TCAGTTTAACTTGATTCCG and HSP-1R: CACTTGAC CAAATCGTCAAACG; HSP-2F: CATACAATATAATA AGTGATGATGGGAG and HSP-2R: CAAGACAGTTAG TTCTCAGTACTAAAC; CPm-1F: CAAGGAACTGTAC AACGTTAACC and CPm-1R: AATTTTATGGTCCAC GAACCTG; CPm-2F: CATTTGGACATTTCAAATTAG ATGGCC and CPm-2R: CGTATTTACATCTTCACCGGA TCC; CP-F: GAATCTTTTAGAAGCTTTGGTTTAAGG and CP-R: GATCCTCTTGATCCTCATAGATTTC).…”

Section: Analysis Of Rt-pcrcontrasting

confidence: 47%

“…The dsRNA was extracted from tomato leaves as described before (Hartono et al 2003) for a reverse transcription reaction using random primers followed by PCR with modified degenerate primers (HSP-1: GGNTTNGANTTN GGNACNAC and HSP-2: TCNAANGTNCCNCCNCCN AA), that had been previously designed and based on the closterovirus heat shock protein 70 homolog (HSP70h) gene (Tian et al 1996). The nucleotide sequence of the RT-PCR products from three samples showed high identity (99-100%) to ToCV isolates from Florida (accession AY903448; Wintermantel et al 2005), Spain (DQ136146; Lozano et al 2006) and Greece (EU284744; Kataya et al 2008).…”

Section: Analysis Of Rt-pcrmentioning

confidence: 99%

“…The disease was likely to be associated with a high population of whitefly and resembled symptoms caused by Tomato infectious chlorosis virus (TICV) Wisler et al 1998a) and Tomato chlorosis virus (ToCV) (Wisler et al 1998a, b), species of the genus Crinivirus in the family Closteroviridae (Martelli et al 2005). TICV has been recently reported in Japan (Hartono et al 2003); however, ToCV has not. Attempts were unsuccessful to detect the known causal agents associated with yellowing symptoms on tomato in Japan (Phytopathological Society of Japan, 2000): Tomato yellow leaf curl virus (TYLCV), Tomato spotted wilt virus, and phytoplasma.…”

Section: Introductionmentioning

confidence: 98%

See 2 more Smart Citations

Yellowing disease of tomato caused by Tomato chlorosis virus newly recognized in Japan

et al. 2010

Self Cite

View full text Add to dashboard Cite

In 2008, virus-like symptoms of yellowing, interveinal chlorosis, leaf curling and necrotic fleck were observed on greenhouse-tomato plants (Solanum esculentum) in Tochigi Prefecture. The symptomatology and the characteristics of the causal agent such as whitefly transmissibility and particle morphology are similar to those for Tomato infectious chlorosis virus (TICV) and Tomato chlorosis virus (ToCV), species of the genus Crinivirus in the family Closteroviridae. Sequencing of reverse transcription-polymerase chain reaction (RT-PCR) products using the degenerate primers for heat shock protein 70 homolog genes of closteroviruses and specific primers for TICV and ToCV indicated that the virus was ToCV, that has not previously been reported in Japan.

show abstract

Section: Analysis Of Rt-pcrcontrasting

confidence: 47%

Section: Analysis Of Rt-pcrmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 98%

See 1 more Smart Citation

Yellowing disease of tomato caused by Tomato chlorosis virus newly recognized in Japan

et al. 2010

Self Cite

View full text Add to dashboard Cite

show abstract

“…Penyakit tersebut ditemukan di Amerika Serikat pada tahun 1998 dan di Jepang pada tahun 2003 serta di beberapa negara Eropa. Setelah diidentifikasi penyakit tersebut disebabkan oleh Tomato infectious chlorosis virus (TICV) yang termasuk dalam kelompok Crinivirus dari famili Closteroviridae yang ditularkan oleh serangga Trialeurodes vaporariorum (Hartono et al, 2003). Kelompok Crinivirus lain yang juga menyerang tanaman tomat adalah Tomato chlorosis virus (ToCV).…”

Section: Intisariunclassified

Infeksi Ganda Begomovirus Dan Crinivirus Pada Tanaman Tomat Di Kabupaten Magelang , Jawa Tengah (Double Infections of Begomovirus and Crinivirus on Tomato Plants at Magelang Regency, Central Java)

Kusumaningrum

Hartono

Sulandari

et al. 2017

JPTI

Self Cite

View full text Add to dashboard Cite

INTISARIPenyakit kuning pada tanaman tomat (Lycopersicon esculentum) telah ditemukan sejak tahun 2006 di Jawa Tengah, Indonesia. Epidemi penyakit tersebut terutama berkaitan dengan keberadaan dua spesies whitefly (Trialeurodes vaporariorum dan Bemisia tabaci). Gejala utama yang ditemukan adalah daun-daun pada tanaman bagian bawah berwarna kuning sedangkan daun daun pada tanaman bagian atas menunjukkan gejala keriting. Adanya gejala campuran pada satu individu tanaman maka perlu dideteksi penyebabnya untuk pengelolaannya. DNA total diekstraksi dari daun tomat yang terinfeksi menggunakan metode CTAB, sedangkan total RNA diekstraksi dengan menggunaan NucleoSpin RNA Plant extraction kit (Macherey-Nagel). Analisis sampel tanaman sakit menggunakan teknik poymerase chain reaction (PCR) menunjukkan adanya infeksi Tomato infectious chlorosis virus (TICV) (famili Closteroviridae, genus Crinivirus) dan satu spesies virus anggota genus Begomovirus, famili Geminiviridae. Hasil penelitian ini merupakan laporan pertama kali adanya infeksi ganda kelompok Crinivirus dan Begomovirus pada satu individu tanaman tomat di Indonesia.

show abstract

“…Menurut Fauquet et al (2005) (Hartono et al, 2003). Panjang sebagian gen protein selubung TICV yang berhasil dirunut dan disejajarkan berkisar 792 pb (Gambar 3).…”

Section: Analisis Perunutan Nukleotida Dan Filogenetikunclassified

Identifikasi Tomato Infectious Chlorosis Virus Penyebab Penyakit Klorosis Pada Tanaman Tomat Di Cipanas Jawa Barat Melalui Perunutan Nukleotida Gen Protein Selubung Utama

Kurniawati¹,

Suastika²,

Giyanto³

2015

JURNAL HAMA DAN PENYAKIT TUMBUHAN TROPIKA

View full text Add to dashboard Cite

Identification of tomato infectious chlorosis virus, the causal agent of chlorosis disease on tomato in Cipanas West Java by sequencing of main coat protein gene nucleotide. Tomato infectious chlorosis virus (TICV) causes chlorosis on tomato.Tomatoes infected by this virus shows interveinal yellowing, necrotic, bronzing, brittleness, and declining in productivity. This study aims to identify the causal agent of chlorotic disease on tomato by sequencing the coat protein gene. The methods involve collecting infected plants, total RNA extraction, cDNA synthesis, DNA amplification, visualization of the results of reverse transcription polymerase chain reaction (PCR), and phylogenetic analysis using BLAST, clustal w, Bioedit v 7.0.5.3, MEGA v 6:06. RT-PCR using spesific primers (CP-F TICV Bam and TICV R-Hind) amplified a DNA band of 792 bp, which has been successfully sequenced and identified as TICV. Nucleotide sequences homology analysis showed that TICV Indonesia_TWJ isolate Cipanas is the same strain as TICV from other countries (99.4 -100%), such as Spain,

show abstract

Yellowing disease of tomatoes caused by Tomato infectious chlorosis virus newly recognized in Japan

Cited by 21 publications

References 9 publications

Yellowing disease of tomato caused by Tomato chlorosis virus newly recognized in Japan

Yellowing disease of tomato caused by Tomato chlorosis virus newly recognized in Japan

Infeksi Ganda Begomovirus Dan Crinivirus Pada Tanaman Tomat Di Kabupaten Magelang , Jawa Tengah (Double Infections of Begomovirus and Crinivirus on Tomato Plants at Magelang Regency, Central Java)

Identifikasi Tomato Infectious Chlorosis Virus Penyebab Penyakit Klorosis Pada Tanaman Tomat Di Cipanas Jawa Barat Melalui Perunutan Nukleotida Gen Protein Selubung Utama

Contact Info

Product

Resources

About