Background and AimInfectious coryza (IC) or snot is an infectious upper respiratory disease affecting chickens and birds, including quails, and it is caused by Avibacterium paragallinarum. The symptoms of IC are facial swelling, malodorous nasal discharge, and lacrimation. This study aimed to isolate, identify, and serotype the A. paragallinarum of snot in quails and to determine the sensitivity and resistance to several antibiotics.Materials and MethodsNine quails from Yogyakarta, Indonesia with typical snot disease symptoms were used in this study. The nasal swab was obtained and directly streaked onto a chocolate agar plate and blood agar plate (BAP), then incubated in 5% CO2 at 37°C for 24-48 h. Staphylococcus spp. was cross-streaked onto the BAP to show the satellite growth. The observation of the morphology of the suspected colony, Gram staining, and biochemical tests (catalase test, oxidase test, urease test, peptone test, and carbohydrate fermentation such as maltose, mannitol, lactose, and sorbitol) are done to identify the species of bacteria. This research also detects the serovar of A. paragallinarum using hemagglutination inhibition test.The antibiotic sensitivity tests were also performed using several antibiotics against five A. paragallinarum isolates that were cultured on Mueller–Hinton Agar and added with antibiotic discs, then incubated in 5% CO2 at 37°C for 24–48 h.ResultsFive isolates out of nine suspected isolates (55.5%) were A. paragallinarum. The growth of isolates from quails did not depend on the nicotinamide adenine dinucleotide (NAD) (NAD-independent). Sensitivity test was done using the five identified A. paragallinarum isolates, results showed that they were 100% sensitive to amoxicillin (AMC) and ampicillin (AMP); 100% resistant toward amikacin (AK), erythromycin (E), gentamycin (CN), and tetracycline (TE); 80% resistant toward kanamycin (K) and trimethoprim (W); 60% resistant toward chloramphenicol (C); and 20% toward enrofloxacin (ENR). The antibiotics that have an intermediate sensitivity (in between sensitive and resistant) were ENR and K, 80% and 20%, respectively. Three out of five A. paragallinarum isolates were identified as serovar B of A. paragallinarum using HI test.ConclusionFive out of nine isolates (55.5%) from quails with typical IC disease symptoms identified as A. paragallinarum and sensitive toward AMC and AMP. Three out of five A. paragallinarum isolates were identified as serovar B.

ABSTRAKPenelitian ini bertujuan untuk mencari alternatif pencegahan penyakit avian influenza (AI) pada ayam pedaging melalui peningkatan daya tahan tubuh. Limfosit T akan bereaksi secara langsung melawan antigen yang telah dipresentasikan ke permukaan sel oleh antigen presenting cell (APC). Interaksi Th-CD4 berperan membantu mampertahankan ikatan Th-APC agar tetap menyatu pada saat aktivasi antigen spesifik berlangsung. Asam lemak pada virgin coconut oil (VCO) berpotensi sebagai immunostimulan sehingga mampu meningkatkan daya tahan tubuh ayam melalui peningkatan limfosit T dan Th-CD4. Penelitian ini menggunakan 40 ekor ayam broiler umur satu hari. Desain penelitian yang digunakan adalah Rancangan Acak Lengkap pola faktorial dengan faktor pertama adalah 2 level vaksin yaitu kelompok ayam yang divaksin AI dan kelompok ayam yang tidak divaksin AI. Faktor kedua menggunakan 4 level VCO yaitu 0, 5, 10 dan 15 mL/kg pakan. Ayam broiler dikelompokkan dalam 8 kelompok perlakuan dan dilakukan pengulangan dalam 5 unit percobaan. Pakan dan minum diberikan ad libitum selama 4 minggu. Hasil penelitian menunjukkan bahwa jumlah limfosit dan Th-CD4 pada ayam yang diberi VCO sebesar 10 mL/kg pakan dan divaksin AI lebih tinggi dibanding pemberian VCO tanpa divaksin AI.Kata kunci: avian influenza, ayam pedaging, CD4, limfosit, VCO ABSTRACTThis research aimed to find preventing alternative of avian influenza (AI) disease in broiler chicken by increasing body immune. Lymphocyte T would directly react to antigen presented to the cell surface by antigen presenting cell (APC). Th-CD4 interaction functioned to maintain Th-APC bond intact during specific antigen activation. Fatty acid in virgin coconut oil (VCO) was potential as immunostimulant, which therefore could increase chicken immunity through the increase of lymphocyte T and Th-CD4. This research used 40 one-day-old broiler chickens. The method applied was Completely Randomized Factorial Design in which the first factor was two levels of vaccine, namely groups of AI vaccinated and unvaccinated. The second factor was four levels of VCO namely 0, 5, 10, 15 mL/kg feed. Day Old Chick (DOC) were divided into eight treatment groups and repeated five times. Feed and water were given ad libitum for four weeks. The result showed that the number of lymphocyte and Th-CD4 in chickens given 10 mL per kg feed and vaccinated with AI was higher than that in chickens given VCO without AI vaccine.

No abstract

Highly pathogenic avian influenza virus (HPAI) differ from Low pathogenic avian influenza virus (LPAI) based on multiple basic amino acid motif of the carboxylterminus of HA1, especially arginine and lysine. The propose of this work was toamplify and sequence the cleavage site region of HA gene of avian influenza virusisolated from both cases with characteristic or unspecific lesion, using reversetranscriptase polymerase chain reaction (RT-PCR). Primer desaigned for amplification and sequence was H5-F: 5' ggagactcagcaatcccatgaaaag 3' and H5-R:5'ccataccaaccgtctaccattcc 3', and expected product size was 246 bp. The result indicated that all avian influenza virus (AIV)-isolates originated from chicken with both specific and non specific lesion show a multiple basic amino acid motif -PQRERRRKKR//GLF-and classified as highly pathogenic avian influenza. Philogenetic study of HA genefragment indicated that each type of characteristic lesion created philo-groups.

Infectious coryza (snot) is one of acute respiratory disease in breeders, layers, and broilers caused by Avibacterium paragallinarum (Av. paragallinarum). This disease is very harmful because of its cause decrease in egg production and high morbidity. Snot incident in Indonesia still is reported. Vaccination is one of the best preventive measures, but reports about Av. paragallinarum serotype at the field so lack so that the correspondence between serotype Av. paragallinarum in the field to those used for vaccination is unknown. Av. paragallinarum has strains with different antigenicity and until now known three serotypes there are serotypes A, B and C. Serotypes A and C are pathogenic then serotypes B. The purpose of this study was to isolate, identify and to determine the serotype of Av. paragallinarum from the commercial layer that showing symptoms of snot. Samples were taken from layer which showed symptoms of snot (nasal foul smelling exudate, infra-orbital and wattle swelling, conjunctivitis, and snoring) from some layer farms. Samples were cultured on chocolate agar and then incubated in a candle jar at 37 ᴼC for 18-24 hours. Bacteria colony and cell morphology were observed and performed biochemical tests (catalase, oxidase, urease, indole, and fermentation of carbohydrates) in suspected colonies. Serotypes test was conducted using plate agglutination test (PAT). This study revealed 4 isolates Av. paragallinarum with 2 isolates are serotype B and 2 other are serotype C.